View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11858_low_15 (Length: 266)
Name: NF11858_low_15
Description: NF11858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11858_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 39 - 247
Target Start/End: Original strand, 10203888 - 10204096
Alignment:
| Q |
39 |
aatgagttggttcttatgctaattttgcatgtactaacgcagaagaacatcaaggaaaatcgatggtgaatgcttaaa-gaaatgatgacgaaaatgtgt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10203888 |
aatgagttggttcttatgctaattttgcatgtactaacgcagaagaacatcaaggaaaatcgatggtgaatgcttaaaagaaatgatgacgaaaatgtgt |
10203987 |
T |
 |
| Q |
138 |
ctttaacaaagaagtagtaccaattacttgaaaagagcaatgtggaatccaagtgtgttttctctgcatttcaattataagctgaattctagacgctgga |
237 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10203988 |
ctttaacaaagaagtagtagcaattacttgaaaagagcaatgtggaatccaagtgtgttttctctgcatttcaattat-agctgaattctagacgctgga |
10204086 |
T |
 |
| Q |
238 |
gtaacacatc |
247 |
Q |
| |
|
|||||||||| |
|
|
| T |
10204087 |
gtaacacatc |
10204096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University