View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11858_low_23 (Length: 215)
Name: NF11858_low_23
Description: NF11858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11858_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 71 - 201
Target Start/End: Original strand, 48598146 - 48598276
Alignment:
| Q |
71 |
tgaacacaatgtagatatagtactgagcaaagatttataagaacaaaccttcttaagcaatgattagtgccatgtattgtatcaataaaaagattttaat |
170 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48598146 |
tgaacacgatgtagatatagtactgagcaaagatttataagaacaaaccttcttaagcaatgattagtgccatgtattgtatcaataaaaagattttaat |
48598245 |
T |
 |
| Q |
171 |
ataggatataaaggttggcttggtggttggt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48598246 |
ataggatataaaggttggcttggtggttggt |
48598276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University