View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_high_13 (Length: 395)
Name: NF1185_high_13
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 68 - 360
Target Start/End: Complemental strand, 52727309 - 52727017
Alignment:
| Q |
68 |
tgaacttgatgttagctacaataagatcaggtccttgcctgattccattggttgtcttaacaagcttcaaaagttgagtgtggaagggaaccctctcact |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52727309 |
tgaacttgatgttagctacaataagatcaggtccttgcctgattccattggttgtcttaacaagcttcaaaagttgagtgtggaagggaaccctctcact |
52727210 |
T |
 |
| Q |
168 |
tcaccaccaccagaagtggtagagaggggattgcatatagtgaaggagtacttgtgcaacaagatgaatgctggtcatcaaagcccaacaaagaagaagt |
267 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52727209 |
tcaccaccaccagaagtcgtagagaggggattgcatatagtgaaggagtacttgtgcaacaagatgaatgctggtcatcaaagcccaacaaagaagaagt |
52727110 |
T |
 |
| Q |
268 |
cttgggttggaaggttggtcaagtatggaacattcaatgttagaagtggagctcgtgaagaacatgaggctttcatcctccccgagtataatc |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52727109 |
cttgggttggaaggttggtcaagtatggaacattcaatgttagaagtggagctcgtgaagaacatgaggctttcatcctccccgagtataatc |
52727017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University