View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_high_17 (Length: 325)
Name: NF1185_high_17
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 98 - 309
Target Start/End: Original strand, 24561186 - 24561397
Alignment:
| Q |
98 |
attatgtgcctgagacatatagtttgtttaattcattcgtgggagcaaattgcaggactgatcatggaagaccatagccaaggcaaatgaatcacacata |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24561186 |
attatgtgcctgagacatatagtttgtttaattcattcgtgggagcaaattgcaggactgatcatggaagaccatagccaaggcaaatgaatcacacata |
24561285 |
T |
 |
| Q |
198 |
ttgatgagcagagtactaattatgaccaggtgatagtttgaataaattgacagtcattcttgtggtcttgctgaaagaacaaagaaggaacttaaacaga |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24561286 |
ttgatgagcagagtactaattatgaccaggtgatagtttgaataaattgacagtcattgttgtggtcttgctgaaagaacgaagaaggaacttaaacaga |
24561385 |
T |
 |
| Q |
298 |
tgtatgcctttg |
309 |
Q |
| |
|
|||||||||||| |
|
|
| T |
24561386 |
tgtatgcctttg |
24561397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University