View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_high_23 (Length: 271)
Name: NF1185_high_23
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_high_23 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 204 - 271
Target Start/End: Complemental strand, 30240259 - 30240192
Alignment:
| Q |
204 |
agtaaaatcttgagtttgacaacccaagatctagataggtatagataagcatatcatgtgaaaaatgt |
271 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30240259 |
agtaaaatcttgagtttgataacccaagatgtagataggtatagataagcatatcatgtgaaaaatgt |
30240192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 23 - 76
Target Start/End: Complemental strand, 30240425 - 30240372
Alignment:
| Q |
23 |
atcatcaccttttgtttcaattctgtctttaatcagcttcaccaaacttccgtt |
76 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||| ||| |||| |
|
|
| T |
30240425 |
atcatcaccttttgtttcaattttgtctttaatcagcttcatcaagctttcgtt |
30240372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 87 - 141
Target Start/End: Complemental strand, 30240377 - 30240323
Alignment:
| Q |
87 |
ttcgttaattttaagtaatttgctgacttgaaactttgagttatttatgacatat |
141 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
30240377 |
ttcgttaactttaagtaatttgtggacttgaaactttgagtcatttatgatatat |
30240323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University