View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_high_35 (Length: 209)
Name: NF1185_high_35
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_high_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 20 - 183
Target Start/End: Original strand, 30240031 - 30240193
Alignment:
| Q |
20 |
agtaagttatattagaactttatcttccacttataatcattcagtggtagtgaatgnnnnnnnnnnnntgaaacacgtttttgcatccatttgtcacatt |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30240031 |
agtaagttatactagaactttatcttccactt-taatcattcagtggtagtgaatggaaaaataaaaatgaaacacgtttttgcatccatttgtcacatt |
30240129 |
T |
|
| Q |
120 |
gcatatttctttgcaaacatagtagttaaaattctctaggtagtaataaagtagtataatgtac |
183 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30240130 |
gcatatttctttgcaaaaatagtagttaaaagtctctaggtagtaataaagtagtataatgtac |
30240193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University