View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_high_36 (Length: 205)
Name: NF1185_high_36
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_high_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 36758955 - 36759068
Alignment:
| Q |
1 |
ctcgtactattcgagttcggaagttattaattgcaatggctattaacattacaacaacatggtgctcacaaatcagttttgatgatacaactctgatcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36758955 |
ctcgtactattcgagttcggaagttattaattgcaatggctattaacattacaacaacatggtgctcacaaatcagttttgatgatacaactctgatcga |
36759054 |
T |
|
| Q |
101 |
tatctactgcttgc |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36759055 |
tatctactgcttgc |
36759068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University