View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_high_6 (Length: 497)
Name: NF1185_high_6
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 30 - 128
Target Start/End: Complemental strand, 22768553 - 22768463
Alignment:
| Q |
30 |
tcatttgtgtggttgccctcaggtgtggatgcagtcgaaaactggttcagtcgtgcagtctgtttgctcgaggccgtttaaacctccaaattttatact |
128 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22768553 |
tcatttgtgtggttgccctcaggtttggatgcagttgaaaactggttcagtcg--------gtttgctcgaggccgtttaaacctccaaattttatact |
22768463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 242 - 358
Target Start/End: Original strand, 2750221 - 2750337
Alignment:
| Q |
242 |
atgtcatcacttttacctcgaataagatattcgctaatcagatctagttctttctgaagtatttgacaaatgcctgcaatcagttaaaaaccaatagaag |
341 |
Q |
| |
|
|||||| || |||||||||||||||||||||||| || |||||||||| || |||||||| ||||||||| || ||| | || ||||| ||| || |
|
|
| T |
2750221 |
atgtcaacatttttacctcgaataagatattcgcaaacaagatctagtttcttatgaagtatcggacaaatgcatgtgatcgatgaagaaccagtaggag |
2750320 |
T |
|
| Q |
342 |
cttcaactttgacttct |
358 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
2750321 |
cttcaacattgacttct |
2750337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 331 - 371
Target Start/End: Complemental strand, 3686117 - 3686077
Alignment:
| Q |
331 |
accaatagaagcttcaactttgacttctgctctatcatttg |
371 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
3686117 |
accaatagaagctttaacattgacttctgcgctatcatttg |
3686077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University