View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_low_17 (Length: 406)
Name: NF1185_low_17
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 128 - 396
Target Start/End: Original strand, 52477420 - 52477686
Alignment:
| Q |
128 |
ctgttgtcaactatttgtatggaagacaacttcattgtttagttttgaatatagtgaaaaactgaaagtgttttctgaaatcaaagtttgcaagatcaga |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477420 |
ctgttgtcaactatttgtatggaagacaacttcattgtttagtttttaatatagtgaaaaactgaaagtgttttctgaaatcaaagtttgcaagatcaga |
52477519 |
T |
|
| Q |
228 |
gaagtgtcttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaaggacaaaaccagcatgagagtcagagtcaaaaa |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52477520 |
gaagtgtcttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaaggacaaaaccagcatgagagtc--agtcaaaaa |
52477617 |
T |
|
| Q |
328 |
taaatcaagtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacctttg |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477618 |
taaatcaagtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacctttg |
52477686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 52477293 - 52477358
Alignment:
| Q |
1 |
tgctcactgcatagtgtctaagtgcaagtgttggtttatatgagtgacgtttagttggatagaata |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477293 |
tgctcactgcatagtgtctaagtgcaagtgttggtttatatgagtgacgtttagttggatagaata |
52477358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University