View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1185_low_26 (Length: 350)

Name: NF1185_low_26
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1185_low_26
NF1185_low_26
[»] chr4 (2 HSPs)
chr4 (94-252)||(56387489-56387647)
chr4 (94-237)||(29733019-29733162)


Alignment Details
Target: chr4 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 94 - 252
Target Start/End: Complemental strand, 56387647 - 56387489
Alignment:
94 tgctgctgctgttgctatcaactggattctcaaggatggagctggtcgtgttggtaagatgctttttgctcgtcaaggcaaaaaatttgattatgatctc 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
56387647 tgctgctgctgttgctatcaactggattctcaaggatggagctggtcgtgttggaaagatgctttttgctcgtcaaggcaaaaaatttgattatgatctc 56387548  T
194 aaacagcttcgttttgccggtgatcttctaatggagttgggtgctggtgtcgaactcgc 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56387547 aaacagcttcgttttgccggtgatcttctaatggagttgggtgctggtgtcgaactcgc 56387489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 94 - 237
Target Start/End: Original strand, 29733019 - 29733162
Alignment:
94 tgctgctgctgttgctatcaactggattctcaaggatggagctggtcgtgttggtaagatgctttttgctcgtcaaggcaaaaaatttgattatgatctc 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||||||||| ||||||    
29733019 tgctgctgctgttgctatcaactggattctcaaggatggagctggtcgtgtcggaaagatgcttttcgctcgccaaggcaaaaaatttgattacgatctc 29733118  T
194 aaacagcttcgttttgccggtgatcttctaatggagttgggtgc 237  Q
    |||||||| |||||  ||||||||||||||||||||||||||||    
29733119 aaacagctccgtttcaccggtgatcttctaatggagttgggtgc 29733162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University