View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_low_26 (Length: 350)
Name: NF1185_low_26
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 94 - 252
Target Start/End: Complemental strand, 56387647 - 56387489
Alignment:
| Q |
94 |
tgctgctgctgttgctatcaactggattctcaaggatggagctggtcgtgttggtaagatgctttttgctcgtcaaggcaaaaaatttgattatgatctc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56387647 |
tgctgctgctgttgctatcaactggattctcaaggatggagctggtcgtgttggaaagatgctttttgctcgtcaaggcaaaaaatttgattatgatctc |
56387548 |
T |
|
| Q |
194 |
aaacagcttcgttttgccggtgatcttctaatggagttgggtgctggtgtcgaactcgc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56387547 |
aaacagcttcgttttgccggtgatcttctaatggagttgggtgctggtgtcgaactcgc |
56387489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 94 - 237
Target Start/End: Original strand, 29733019 - 29733162
Alignment:
| Q |
94 |
tgctgctgctgttgctatcaactggattctcaaggatggagctggtcgtgttggtaagatgctttttgctcgtcaaggcaaaaaatttgattatgatctc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||||||||| |||||| |
|
|
| T |
29733019 |
tgctgctgctgttgctatcaactggattctcaaggatggagctggtcgtgtcggaaagatgcttttcgctcgccaaggcaaaaaatttgattacgatctc |
29733118 |
T |
|
| Q |
194 |
aaacagcttcgttttgccggtgatcttctaatggagttgggtgc |
237 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
29733119 |
aaacagctccgtttcaccggtgatcttctaatggagttgggtgc |
29733162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University