View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_low_29 (Length: 338)
Name: NF1185_low_29
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 89 - 240
Target Start/End: Complemental strand, 56387640 - 56387489
Alignment:
| Q |
89 |
gctgttgctatcaactggattctcaaggatggagctggtcgtgttggtaagatgctttttgctcgtcaaggcaaaaaatttgattatgatctcaaacagc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56387640 |
gctgttgctatcaactggattctcaaggatggagctggtcgtgttggaaagatgctttttgctcgtcaaggcaaaaaatttgattatgatctcaaacagc |
56387541 |
T |
|
| Q |
189 |
ttcgttttgccggtgatcttctaatggagttgggtgctggtgtcgaactcgc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56387540 |
ttcgttttgccggtgatcttctaatggagttgggtgctggtgtcgaactcgc |
56387489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 89 - 225
Target Start/End: Original strand, 29733026 - 29733162
Alignment:
| Q |
89 |
gctgttgctatcaactggattctcaaggatggagctggtcgtgttggtaagatgctttttgctcgtcaaggcaaaaaatttgattatgatctcaaacagc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
29733026 |
gctgttgctatcaactggattctcaaggatggagctggtcgtgtcggaaagatgcttttcgctcgccaaggcaaaaaatttgattacgatctcaaacagc |
29733125 |
T |
|
| Q |
189 |
ttcgttttgccggtgatcttctaatggagttgggtgc |
225 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
29733126 |
tccgtttcaccggtgatcttctaatggagttgggtgc |
29733162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University