View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_low_30 (Length: 328)
Name: NF1185_low_30
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 29 - 323
Target Start/End: Original strand, 5750614 - 5750908
Alignment:
| Q |
29 |
actattgttattattgttattgttgctgctattcttgtcacatgtggacattcgatacggagttaacgtttcgaatgtttcaccaaattgtttgacaata |
128 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750614 |
actattgttattattgttattgttgttgctattcttgtcacatgtggacattcgatacggagttaacgtttcgaatgtttcaccaaattgtttgacaata |
5750713 |
T |
 |
| Q |
129 |
tttttgagagggagaaggtagtaaatttcaccagcttgaagttcttcgtttttcgagagtggtttagagagtgtgttacggttgtttttgaaaattccat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750714 |
tttttgagagggagaaggtagtaaatttcaccagcttgaagttcttcgttttttgagagtggtttagagagtgtgttacggttgtttttgaaaattccat |
5750813 |
T |
 |
| Q |
229 |
ggtgtggaaactcgttggttatgcattcaaccgttatgggagaataaagttccatgatgcctccatttgatgttacaattcttacctttgcttct |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
5750814 |
ggtgtggaaactcgttggttatgcattcaaccgttatgggagaataaagttccatgatgcctccatttgatgttacaattcttaccattgtttct |
5750908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University