View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_low_40 (Length: 312)
Name: NF1185_low_40
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 60 - 243
Target Start/End: Original strand, 31467697 - 31467879
Alignment:
| Q |
60 |
aaaattgtctatgtttatattttactatgacaaacaataaagtaccaaggtcaattaatcacttttgaaggtagaattgtatcgaccgcaaattgttttt |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31467697 |
aaaattgtctatgtttatattttactatgacaaacaataaagtaccaaggtcaattaatcacttttgaaggtagaattgtatcaaccgcaaattgttttt |
31467796 |
T |
|
| Q |
160 |
agattttacgcatggccaactctttgttgttgtattagagtaaaagaagnnnnnnnncatgattgaatatgttgacgttgttgc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
31467797 |
agattttacgcatggccaactctttgttgttgtattagagtaaaagaag-aaaaaaacatgattgaatatgttgatgttgttgc |
31467879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University