View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_low_56 (Length: 249)
Name: NF1185_low_56
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_low_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 54732910 - 54733129
Alignment:
| Q |
1 |
gtcacttctcacaacatgattctgcaaaaagaagaagttcagaacatgatctttatctcgagtttctcaagaatagcaacatgtatcagaaaatccaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54732910 |
gtcacttctcacaacatgattctgcaaaaagaagaagttcagaacatgatctttatctcgagtttctcaagaatagcaacatgtatcagaaaatccaagg |
54733009 |
T |
|
| Q |
101 |
ttttgatcagaaaaaacccagggtaaaagttgagagcaacgtaaagggtcgtagaatatacgatggatgcatggtgaaattctctgaaaaagagagtata |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54733010 |
ttttgatcagaaaaaacccagcgtaaaagttgagagcaacgtaaaaggtcgtagaataaacgatggatgcatggtgaaattctctcaaaaagagagtata |
54733109 |
T |
|
| Q |
201 |
aagagtgaagatgataacaa |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
54733110 |
aagagtgaagatgataacaa |
54733129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University