View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_low_64 (Length: 216)
Name: NF1185_low_64
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_low_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 34 - 212
Target Start/End: Original strand, 32648751 - 32648929
Alignment:
| Q |
34 |
acatcaaataatatactaaatggtggaacaccttcccaaatccttatgcggaaactttagtgtaccaaacaattttagtttcttagaatcacatgaaaat |
133 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32648751 |
acatcaaataatacactaaatggtggaacacctttccaaatccttatgcggaaactttaatgtaccaaacaattttagtttcttagaatcacatgaaaat |
32648850 |
T |
 |
| Q |
134 |
gacnnnnnnnncccaacaatagttgattaccgtcagttttctgttttgaagccaacagtagttgccaccgaagtttttt |
212 |
Q |
| |
|
||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32648851 |
gacaaaaaaaacccaacaatagttgattaccgtcaattttctgttttgaagccaacagtagttgccactgaagtttttt |
32648929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University