View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1185_low_67 (Length: 209)

Name: NF1185_low_67
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1185_low_67
NF1185_low_67
[»] chr1 (1 HSPs)
chr1 (1-122)||(22618758-22618879)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 22618879 - 22618758
Alignment:
1 tagaagtgtaagccactaggggatttttcgaagacatagttttctcacccttttatgaccttttctctcgcaagcaacttgctaactgcaggtgtaccat 100  Q
    |||||||||||||||||| |||||||||  ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||    
22618879 tagaagtgtaagccactaagggatttttttaagacatagttttctcagccttttatgaccttttctctcgcaagcaacttgctaactacaggtgtaccat 22618780  T
101 tatgaatccagatggccttcat 122  Q
    ||||||||||||||||||||||    
22618779 tatgaatccagatggccttcat 22618758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University