View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1185_low_70 (Length: 205)

Name: NF1185_low_70
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1185_low_70
NF1185_low_70
[»] chr8 (1 HSPs)
chr8 (1-114)||(36758955-36759068)


Alignment Details
Target: chr8 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 36758955 - 36759068
Alignment:
1 ctcgtactattcgagttcggaagttattaattgcaatggctattaacattacaacaacatggtgctcacaaatcagttttgatgatacaactctgatcga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36758955 ctcgtactattcgagttcggaagttattaattgcaatggctattaacattacaacaacatggtgctcacaaatcagttttgatgatacaactctgatcga 36759054  T
101 tatctactgcttgc 114  Q
    ||||||||||||||    
36759055 tatctactgcttgc 36759068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University