View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_low_72 (Length: 202)
Name: NF1185_low_72
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_low_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 41 - 194
Target Start/End: Original strand, 11800439 - 11800592
Alignment:
| Q |
41 |
gttaacttcgtcattaggaggataattcagctactaagtttgttagatgaacaaccgattatcccccactttacctcttgaagcatgttctatgttttaa |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11800439 |
gttaacttcgtcattaggaggataattcagctactaagtttgttagatgaacaaccgattatcccccactttacctcttgaagcatgttctgtgttttaa |
11800538 |
T |
 |
| Q |
141 |
gagtgttttgttcccttagctatatatgctccaactgtaaatgttcatctcact |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
11800539 |
gagtgttttgttcccttagctatatatgcttcaactataaatgttcatcgcact |
11800592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University