View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1185_low_8 (Length: 505)
Name: NF1185_low_8
Description: NF1185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1185_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 30 - 369
Target Start/End: Original strand, 46184842 - 46185189
Alignment:
| Q |
30 |
cattgatcatcgtttcaagcccaatatgggtcccagctggtacctttctcttcctccttgcagctggattcttgtccatgtgtggatttggtgttgttgc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184842 |
cattgatcatcgtttcaagcccaatatgggtcccagctggtacctttctcttcctccttgctgctggattcttgtccatgtgtggatttggtgttgttgc |
46184941 |
T |
 |
| Q |
130 |
tgtagctgcttcctcttggttctaccgttactttagaggtcttcatcctcccggttcggaccgggttgattatgcaaggaaccgcctttatgatactgct |
229 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184942 |
tgtagctgcttcctcttggttctatcgttactttagaggtcttcatcctcccggttcggaccgggttgattatgcaaggaaccgcctttatgatactgct |
46185041 |
T |
 |
| Q |
230 |
tctcatgttaaagattatgcaagagaatatggtggttatttgcagagtaaggttaaggatgcagctcctggtgcttgattgaaccaaaccggttc----- |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185042 |
tctcatgttaaagattatgcaagagaatatggtggttatttgcagagtaaggttaaggatgcagctcctggtgcttgattgaaccaaaccggttcggttg |
46185141 |
T |
 |
| Q |
325 |
---ggttggttcactagcttatactatcatatatttatattcaaccgg |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185142 |
gttggttggttcactagcttatactatcatatatttatattcaaccgg |
46185189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 392 - 500
Target Start/End: Original strand, 46185227 - 46185335
Alignment:
| Q |
392 |
atgtatggttcaaaattaagttaaggtgtgtgtacgtaatcataattgttagtggaattaagttatgtcatctttatattcttttgttacttttttggtc |
491 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185227 |
atgtatggttcaatattaagttaaggtgtgtgtacgtaatcataattgttagtggaattaagttatgtcatctttatattcttttgttacttttttggtg |
46185326 |
T |
 |
| Q |
492 |
tgtggtgct |
500 |
Q |
| |
|
|||| |||| |
|
|
| T |
46185327 |
tgtgatgct |
46185335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University