View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11860_low_12 (Length: 329)
Name: NF11860_low_12
Description: NF11860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11860_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 138 - 313
Target Start/End: Complemental strand, 46455870 - 46455695
Alignment:
| Q |
138 |
aatgcacaggaggtggtggggattgaactggtggtggcggtgatcgtgttcttcttttgggtgcttcattatgaggatcatcctcaattggtggttctgc |
237 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46455870 |
aatgcacaggaggtggtgaggattgaactggtggcggcggtgatcgtgttcttcttttgggtgcttcattatgaggatcatcctcaattggtggttctgc |
46455771 |
T |
 |
| Q |
238 |
ttgaggtgtagaaggggttggtggtggactggatggtgttggtttaggttgtggacttggtgttggctttgatgtc |
313 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46455770 |
ttcaggtgtagaaggggttggtggtggactggatggtgttggtttaggttgtggacttggtgttggctttggtgtc |
46455695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University