View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11860_low_12 (Length: 329)

Name: NF11860_low_12
Description: NF11860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11860_low_12
NF11860_low_12
[»] chr3 (1 HSPs)
chr3 (138-313)||(46455695-46455870)


Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 138 - 313
Target Start/End: Complemental strand, 46455870 - 46455695
Alignment:
138 aatgcacaggaggtggtggggattgaactggtggtggcggtgatcgtgttcttcttttgggtgcttcattatgaggatcatcctcaattggtggttctgc 237  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46455870 aatgcacaggaggtggtgaggattgaactggtggcggcggtgatcgtgttcttcttttgggtgcttcattatgaggatcatcctcaattggtggttctgc 46455771  T
238 ttgaggtgtagaaggggttggtggtggactggatggtgttggtttaggttgtggacttggtgttggctttgatgtc 313  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
46455770 ttcaggtgtagaaggggttggtggtggactggatggtgttggtttaggttgtggacttggtgttggctttggtgtc 46455695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University