View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11860_low_15 (Length: 315)
Name: NF11860_low_15
Description: NF11860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11860_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 7 - 296
Target Start/End: Complemental strand, 35096003 - 35095714
Alignment:
| Q |
7 |
gcaattgagatagcttacaacaaaggctggactaatctatggttagaaactgattcgacattggttctgttaagtcttcgtcctttgttccataaaacat |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35096003 |
gcaattgagatagcttacaataaaggctggactaatctatggttagaaactgattcgacattggttctgttaagccttcgtcctttgttccataaaacat |
35095904 |
T |
 |
| Q |
107 |
aaggaatagatgggaaaattgcattgatttaacaaaacaaatgaacttcatagtctctcgtatatttagagaaggaaattgtggtgccgatagtttagca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35095903 |
aaggaatagatgggaaaattgcattgatttaacaaaacaaatgaacttcatagtctctcgtatatttagagaaggaaattgtggtgccgatagtttagca |
35095804 |
T |
 |
| Q |
207 |
tatattgggttgtctatcaactcttttctctcgatgaatgacattccatctcatgccagagctgacttctctaggaataggctttgttga |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35095803 |
tatattgggttgtctatcaactcttttctctcgatgaatgacattccatctcatgccagagctgacttctctaggaataggctttgttga |
35095714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University