View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11860_low_16 (Length: 314)
Name: NF11860_low_16
Description: NF11860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11860_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 8 - 308
Target Start/End: Original strand, 50136288 - 50136588
Alignment:
| Q |
8 |
caaaggttgtgcatcttctagagtctctagaccttcaattgctctaatatttatctttgccaatcagcttcctattggtgcacattttcacaaacatatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50136288 |
caaaggttgtgcatcttctagagtctctaaaccttcaattgctctaatatttatcttcgccaatcagcttcctattggtacacattttcacaaacatatt |
50136387 |
T |
|
| Q |
108 |
atgattagtgcacattttaacaataaaaaaccaatacatgaagaaattcaagcacaacttaggctaaagtttgaagtatcagtagaagtgtggttcagta |
207 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||| |
|
|
| T |
50136388 |
atgatcagtgcacattttaacaataaaaaaccaatacatgaagaaattcaagcacaacttaggctaaagtttaaagtatcaatagaagtgtggttcggta |
50136487 |
T |
|
| Q |
208 |
ctttgatcaagcagtttgcgggcatacccaaaacgacgagagtttgaatagagtgttaacaaatggtttctgagaattgggtggcgggaaaatccaaact |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
50136488 |
ctttgatcaagcagtttgcgggcatacccaaaacgacgagagtttgaatagagtgttaacaaatggtttctgagaattgcgtggcgagaaaatccaaact |
50136587 |
T |
|
| Q |
308 |
t |
308 |
Q |
| |
|
| |
|
|
| T |
50136588 |
t |
50136588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 198 - 308
Target Start/End: Original strand, 50133471 - 50133581
Alignment:
| Q |
198 |
tggttcagtactttgatcaagcagtttgcgggcatacccaaaacgacgagagtttgaatagagtgttaacaaatggtttctgagaattgggtggcgggaa |
297 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
50133471 |
tggttcagtactttgatcaagcaggttgcaggcatacccaaaacgacgagagttggaatagaatgttaacaaatggtttctgagacttgagtggcgggaa |
50133570 |
T |
|
| Q |
298 |
aatccaaactt |
308 |
Q |
| |
|
||||||||||| |
|
|
| T |
50133571 |
aatccaaactt |
50133581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University