View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11860_low_19 (Length: 285)
Name: NF11860_low_19
Description: NF11860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11860_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 3 - 267
Target Start/End: Complemental strand, 48889109 - 48888845
Alignment:
| Q |
3 |
cagcaatgagatggacatcagaggtgtagtttcacttttatgtttgatatgggcattgatgacagaacagctgaacataaaatgtatctattggttattt |
102 |
Q |
| |
|
||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48889109 |
cagcaatcagagtgacattagaggtgtagtttcacttttatgtttgatatgggcatcgatgacagaacagctgaatataaaatgtatctattggttattt |
48889010 |
T |
 |
| Q |
103 |
tttaagcttgacaattgaagagcccatatgatgataatgattagttatgacacatatatatcagttaccttgttgtcaaatccagaagtaacaacttctt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48889009 |
tttaagcttgacaattgaagagcccatatgatgataatgattagttatgacacatatatatcagttaccttgttgtcaaatccagaagtaacaacttctt |
48888910 |
T |
 |
| Q |
203 |
cttcagcagctgctaacaatttgattaatccaaattgtttactgtcaaacttaccactatagcca |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888909 |
cttcagcagctgctaacaatttgattaatccaaattgtttactgtcaaacttaccactatagcca |
48888845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University