View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11861_low_17 (Length: 285)
Name: NF11861_low_17
Description: NF11861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11861_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 69 - 275
Target Start/End: Original strand, 15770489 - 15770695
Alignment:
| Q |
69 |
aaagagacattgttggaggatgttacctagaaagtgcaaatgctaatcctatgcatttgtcactatagattttgctcatatgtcatattcaagaccggtt |
168 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15770489 |
aaagaaacattgtcggaggatgttacctagaaagtgcaaatgctaatcctatgcatttgtcactatagattttgctcatatgtcatattcaagaccggtt |
15770588 |
T |
|
| Q |
169 |
tggaattaagctactaatctcatccatttcagtatatccaaagaatcatattaattctttataccttggaagacttgtaaatgatggaacatctacgcgg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15770589 |
tggaattaagctactaatctcatccatttcagtatatccaaagaatcatattaattctttataccttggaagacttgtaaatgatggaacatctacgcgg |
15770688 |
T |
|
| Q |
269 |
ttctctg |
275 |
Q |
| |
|
|| |||| |
|
|
| T |
15770689 |
ttttctg |
15770695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 111 - 191
Target Start/End: Complemental strand, 15796204 - 15796123
Alignment:
| Q |
111 |
ctaatccta-tgcatttgtcactatagattttgctcatatgtcatattcaagaccggtttggaattaagctactaatctcat |
191 |
Q |
| |
|
||||||||| || ||||||| |||||||||||| ||||||||||| |||| | |||| ||||||| ||||||| |||||||| |
|
|
| T |
15796204 |
ctaatcctaatgtatttgtcgctatagattttgttcatatgtcatgttcatggccggcttggaatcaagctaccaatctcat |
15796123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University