View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11861_low_20 (Length: 256)
Name: NF11861_low_20
Description: NF11861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11861_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 50 - 206
Target Start/End: Original strand, 32108769 - 32108926
Alignment:
| Q |
50 |
tttttcagtgaggtgcaggaaa-gacctaggtgatggatattgtggagttgtaaccgatgaaatagatttagctttctgagaaagagtagatctgagtaa |
148 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||||| ||||| ||||||||||||||||||||||||| | |
|
|
| T |
32108769 |
ttttttagtgaggtgcaggaaaagacctaggtgatggatgttgtggagttgtaactgatgaaatagttttagttttctgagaaagagtagatctgagtga |
32108868 |
T |
 |
| Q |
149 |
gggtattgagtgtgtagaaggaatatataaagaaaagaaaatataattattatcatta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
32108869 |
gggtattgagtgtgtagaaggaatatataaagaaaagaaaatataataattattatta |
32108926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 101 - 206
Target Start/End: Original strand, 32078508 - 32078612
Alignment:
| Q |
101 |
aaccgatgaaatagatttagctttctgagaaagagtagatctgagtaagggtattgagtgtgtagaaggaatatataaagaaaagaaaatataattatta |
200 |
Q |
| |
|
|||||||||||||| ||||| ||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||| | ||||||||||||| ||||||| |
|
|
| T |
32078508 |
aaccgatgaaatagttttagttttcttagaaagagtggatctgagtcagggtattgagtgtgtagaaggaatatat-aggaaaagaaaatatgattatta |
32078606 |
T |
 |
| Q |
201 |
tcatta |
206 |
Q |
| |
|
| |||| |
|
|
| T |
32078607 |
ttatta |
32078612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University