View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11861_low_27 (Length: 228)
Name: NF11861_low_27
Description: NF11861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11861_low_27 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 11 - 228
Target Start/End: Complemental strand, 28928081 - 28927864
Alignment:
| Q |
11 |
attgccactatcacggtagtggtgatgtttgaatgaacatgtcaaatattataactctattaactaaaccgaaaggcaaaacaaatagatttatagttaa |
110 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
28928081 |
attgccactatcacgctagtgatgatgtttgaatgaacatgtcaaatattataactctattaactaaactgaaaagcaaaacaaatagatttatagttaa |
28927982 |
T |
 |
| Q |
111 |
ttatcatcatactaaaattcctagaaaaactatttttcttacttataatccagcatgtcacgcatacaaacaaccagccaaaacacaaattaaaaacttg |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
28927981 |
ttatcatcatactaaaattccaagaaaaactatttttcttacttataatccagcatgtcacacatacaaacagccagccaaaacatgaattaaaaacttg |
28927882 |
T |
 |
| Q |
211 |
tattcagaaccaaagcac |
228 |
Q |
| |
|
|||| ||||| ||||||| |
|
|
| T |
28927881 |
tatttagaacaaaagcac |
28927864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University