View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11862_high_11 (Length: 242)
Name: NF11862_high_11
Description: NF11862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11862_high_11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 76 - 242
Target Start/End: Original strand, 38502955 - 38503121
Alignment:
| Q |
76 |
accacaagcatggtgattcattcataggcgctgatggaaaagtgtaccatagccacgacggtcttgcaccacactcccacgaaccaatctactctcccgg |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38502955 |
accacaagcatggtgattcattcataggcgctgatggaaaagtgtaccatagccacgacggtcttgcaccacactcccacgaaccaatctactctcccgg |
38503054 |
T |
 |
| Q |
176 |
attcttcagcagaagagctcaacctcttatcaacagagacttcaacgaaagagctttcaccgttggc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38503055 |
attcttcagcagaagagctcaacctcttatcaacagagacttcaacgaaagagctttcactgttggc |
38503121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University