View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11862_high_14 (Length: 220)

Name: NF11862_high_14
Description: NF11862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11862_high_14
NF11862_high_14
[»] chr8 (1 HSPs)
chr8 (122-201)||(27780730-27780809)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 122 - 201
Target Start/End: Complemental strand, 27780809 - 27780730
Alignment:
122 atatattcaattcaagacaaattcaattgtaaccacaaacttatgcaatctgtcataatataattttacttcaaatatat 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27780809 atatattcaattcaagacaaattcaattgtaaccacaaacttatgcaatctgtcataatataattttacttcaaatatat 27780730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University