View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11862_low_13 (Length: 245)
Name: NF11862_low_13
Description: NF11862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11862_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 2 - 229
Target Start/End: Original strand, 38503653 - 38503880
Alignment:
| Q |
2 |
ataagtatcaaaaatttagtctctcaaactagctgaaattgtcttcgaaattgaaaaactttgatcatattattactcttggatccataagtttggttcg |
101 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38503653 |
ataagtatcgaaaatttagtctctcaaactagctgaatttgtcttcgaaattgaaaaactttgatcatattattactcttggatccataagtttggtttg |
38503752 |
T |
 |
| Q |
102 |
ggaaattgctgtggatgaactacttcaatctgac-ttttttggttttagataacattttgaaattttattaatttgagagatcaaattacgcgtctccta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38503753 |
ggaaattgctgtggatgaactacttcaatc-gacggtttttggttttagataacattttgaaattttattaatttgagagatcaaattacgcgtcaccta |
38503851 |
T |
 |
| Q |
201 |
caatctcaggggctaaaatgaagatctac |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38503852 |
caatctcaggggctaaaatgaagatctac |
38503880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University