View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11863_low_8 (Length: 229)
Name: NF11863_low_8
Description: NF11863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11863_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 35 - 218
Target Start/End: Original strand, 43383963 - 43384150
Alignment:
| Q |
35 |
ataatcattcttcttctcccctcactcttgatttgaggttgggactttaattaattaatttcttcttctttactcttctaatatatattttactacttag |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43383963 |
ataatcattcttcttctcccctcactcttgatttgaggttgggactttaattaattaatttcttcttctttactcttctaatatatattttactacttaa |
43384062 |
T |
 |
| Q |
135 |
ttaagttattaggtcatc----atcaccgttgctcatgtatgtttcattttatttgcatcctaattctaattacccctcttatttcat |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
43384063 |
ttaagttattaggtcatcatcgatcaccgttgctcatgtttgtttcattttatttgcaccctaattctaattacctctcttatttcat |
43384150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 25870636 - 25870684
Alignment:
| Q |
38 |
atcattcttcttctcccctcactcttgatttgaggttgggactttaatt |
86 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
25870636 |
atcattcttcttctcccctcactcttcatttgaggttgtgactttaatt |
25870684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University