View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11864_low_20 (Length: 285)
Name: NF11864_low_20
Description: NF11864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11864_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 25 - 275
Target Start/End: Original strand, 49465313 - 49465563
Alignment:
| Q |
25 |
ataattaatctacactaatgattttgattatgttgtagatgtttcaagtagcagtaggagagcggtcatattcagcagcatagctacgttgccatgtctt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49465313 |
ataattaatctacactaatgattttgattatgttgtagatgtttcaagtagcagtaggagagcggtcatattcagcagcatagctacgttgccatgtctt |
49465412 |
T |
|
| Q |
125 |
cttcccctcactcatatatttggttctcttcaagctaacgccatgccgtaagcacctaatcatatttctgtattaattaattaaatctatattataatca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49465413 |
cttcccctcactcatatatttggttctcttcaagctaacgccatgccgtaagcacctaatcatatttctgtattaattaattaaatctatattataatca |
49465512 |
T |
|
| Q |
225 |
tgatcacaagttagcttagtacaatgcctaaaattataatcaccctttcat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49465513 |
tgatcacaagttagcttagtacaatgcctaaaattataatcaccctttcat |
49465563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University