View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11864_low_23 (Length: 254)
Name: NF11864_low_23
Description: NF11864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11864_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 16 - 240
Target Start/End: Original strand, 9566482 - 9566706
Alignment:
| Q |
16 |
caacatacaacatggagggttggatatgtcgtttgaaacctagacatatgagctttcctaagaacaactaatcactcaaatccgtgacatgagattaatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9566482 |
caacatacaacatggagggttggatatgtcgtttgaaacctagacatatgagctttcctaagaacaactaatcactcaaatccgtgacatgagattaatc |
9566581 |
T |
 |
| Q |
116 |
atttcttgtacaaaaagcaatataatactaatgctgaaattcttacatccacttgttggatggagaaagctgctattaggacgaaatttgtgtatgtttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9566582 |
atttcttgtacaaaaagcaatataatactaatgctgaaattcttacatccacttgttggttggagaaagctgttattaggacgaaatttgtgtatgtttt |
9566681 |
T |
 |
| Q |
216 |
tgtggatcgataaatgttatttgtc |
240 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
9566682 |
tgtggatcgacaaatgttatttgtc |
9566706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University