View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11865_high_10 (Length: 361)
Name: NF11865_high_10
Description: NF11865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11865_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 14 - 342
Target Start/End: Original strand, 31924995 - 31925323
Alignment:
| Q |
14 |
cagagaactatgacaaagaagtctggaagcgtcatgaggggttcttgaatggcgcagatagggactcttggcccagttatgagacaggtcactgctatcc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31924995 |
cagagaactatgacaaagaagtctggaagcgtcatgaggggttcttgaatggcgcagatagggacccttggcccagttatgagacaggtcactgctatcc |
31925094 |
T |
|
| Q |
114 |
actcttaatcaaaatcaccctgtaaactttcttctagacattctgcctgggacctcctttcattggttgactgttcgtaaagataagtggaaatctattc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31925095 |
actcttaatcaaaatcaccctgtaaactttcttctagacattctgcctgggacctcctttcattggttgactgttcgtaaagataagtggaaatctattc |
31925194 |
T |
|
| Q |
214 |
ctcctccaacagaggaaatgtctagtgcagacacttaccaattgcacgcttatgtaattttttgttggggtcacatcttcattagacagtacatatgtca |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31925195 |
ctcctccaacagaggaaatgtctagtgcagacacttaccaattgcacgcttatgtaattttttgttggggtcacatcttcattagacagtacatttgtca |
31925294 |
T |
|
| Q |
314 |
tccaagaaggcacagatgaatgtgaaggg |
342 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31925295 |
tccaagaaggcacagatgaatgtgaaggg |
31925323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University