View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11865_high_18 (Length: 242)
Name: NF11865_high_18
Description: NF11865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11865_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 20 - 190
Target Start/End: Complemental strand, 32351626 - 32351449
Alignment:
| Q |
20 |
atggcctgctcatcatggacatggtcgactcgttccttcatcttgcttacagtcgtcactcttatgcctgaccatcataagcataatttcaacttttttc |
119 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32351626 |
atggcctgctcgtcatggacatggtccactcgttccttcaacttgcttacagtcgtcactcttgtgcctgaccgtcataagcataatttcaacttttttc |
32351527 |
T |
 |
| Q |
120 |
tttagtttttgcctctaatacccaagttcctgaaatacaaac-------caaccaacaaccatgccaaaaacaataaa |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
32351526 |
tttagtttttgcctctaatacccaagttcctgaaatacaaaccaactaccaaccaacaaccataccaaaaacaataaa |
32351449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 201 - 242
Target Start/End: Complemental strand, 32351417 - 32351376
Alignment:
| Q |
201 |
ttcaaatgatgtatttcgcatgttatcacctagtgtttatgc |
242 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32351417 |
ttcaaatgatgtattttgcatgttatcacctagtgtttatgc |
32351376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University