View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11865_low_15 (Length: 265)
Name: NF11865_low_15
Description: NF11865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11865_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 43000706 - 43000471
Alignment:
| Q |
17 |
agtttttatctagttctgttttttgctcttgcttccattgtcttctcattttcattttgatgccatagttgaaaaatttgttcagatagattgaatcatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43000706 |
agtttttatctagttctgttttttgctcttccttccattgtcttctcatttgcattttgatgccatagttgaaaattttgttcagatagattgaatcatt |
43000607 |
T |
|
| Q |
117 |
cagatattaatttaggcacaaagctatggctgaggaacccagacaaactcttggggattactggaagcctcgcagaatacaaagctgcattgtcctccct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43000606 |
cagatattaatttaggcacaaagctatggctgaggaacccagacaaactcttggggattactggaagcctcgcagaatacaaagctgcattgtcctccct |
43000507 |
T |
|
| Q |
217 |
cctgttgatgcggatgttagttacgacctctcatct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43000506 |
cctgttgatgcggatgttagttacgacctctcatct |
43000471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University