View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11866_low_14 (Length: 390)
Name: NF11866_low_14
Description: NF11866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11866_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 52012662 - 52012398
Alignment:
| Q |
1 |
agacgcggaatgaatgtggagaacgttgagatacgcgggcggggataaaattggaattcttctttaataaaataggggaatgtggtggtggtg---ttac |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52012662 |
agacgcggaatgaatgtggagaacgttgagatacgcgggcggggataaaattggaattcttctttaataaaataggggaatgtggtggtggtggttttac |
52012563 |
T |
|
| Q |
98 |
acttacaagagtagtagttgttggcatg----gtctgagtgcgtcaatttaataaataatgccaataagaatgaatataacagaaccccagatggactgc |
193 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
52012562 |
acttacaag---agtagttgttggcatggtctgtctgagtgcgtcagtttaataaataatgccaataa----gaatataacagaaccccagacggactgc |
52012470 |
T |
|
| Q |
194 |
g------tctttggattgcttatcctacgattcaaatatgccacgttatcatatgactcgactcactcacca |
259 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52012469 |
gtctctctctttggattgcttatcctacgattcaaatatgccacgttatcatatgactcgactcactcacca |
52012398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 293 - 371
Target Start/End: Complemental strand, 52012397 - 52012313
Alignment:
| Q |
293 |
taattcaacgagtatttctgctttgttcgttcctttcatctcatttacatt------agattcaatctaaatctgagtagttatt |
371 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52012397 |
taattcaacgattatttctgctttgttcgttcctttcatctcatttacatttacatcggattcaatctaaatctgagtagttatt |
52012313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University