View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11866_low_17 (Length: 356)
Name: NF11866_low_17
Description: NF11866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11866_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 67 - 342
Target Start/End: Original strand, 2976044 - 2976320
Alignment:
| Q |
67 |
gacgttgaatccaataccaactgtgacatctaacaaactcttctcatgttccatgagttaggaaaaacacatacatagatacatacataaactcaaacgc |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
2976044 |
gacgttgaatccaataccaactgtgacatctaacaaactcttctcatgttccatgagttaggaaaaacacatacata--------cacaaactcaaacgc |
2976135 |
T |
 |
| Q |
167 |
ttacgttg---------ttgttggtgttgtttcacaagaaaatttttccacctacttcaccgcaaattgcagttttttatagttaccatcatcaattcat |
257 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2976136 |
ttacgttgttgttgttgttgttggtgttgtttcacaagaaattttttccacctacttcaccgcaaattgcagttttttatagttaccatcatcaattcat |
2976235 |
T |
 |
| Q |
258 |
catcataaatttggcagtcagagtcacctaaatgacttcttcatttaagaccctcaacaaacaattccctcttctacctcctttc |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2976236 |
catcataaatttggcagtcagagtcacctaaatgacttcttcatttaagaccctcaacaaacaattccctcttctacctcctttc |
2976320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 2975981 - 2976013
Alignment:
| Q |
17 |
gtggtgtaaattgcatggcatggcatgttagac |
49 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
2975981 |
gtggtgcaaattgcatggcatggcatgttagac |
2976013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University