View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11866_low_23 (Length: 254)
Name: NF11866_low_23
Description: NF11866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11866_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 3 - 241
Target Start/End: Original strand, 10858706 - 10858944
Alignment:
| Q |
3 |
accagccctgatgcccttccctttttccctgaaggtattgactttagagcagttgccaaatttgaagaatgtttggaatgaagatcctcatggaattcta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10858706 |
accagccctgatgcccttccctttttccctgaaggtattgactttagagcagttgccaaatttggagaatgtttggaatgaagatcctcatggaattcta |
10858805 |
T |
|
| Q |
103 |
acaattgaacttctaaaacaagtatatgttgatgactgtaaaggccttacaagtttgttcccagcctcagtagccaaagatcttgtgaaacttgaagatc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10858806 |
acaattgaacttctaaaacaagtatatgttgatgactgtaaaggccttataagtttgttcccagcctcagtagccaaagatcttgtgaaacttgaagatc |
10858905 |
T |
|
| Q |
203 |
tacacgtgaaacactgtgaagagctgatggttattgttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10858906 |
tacacgtgaaacactgtgaagagctgatggttattgttg |
10858944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University