View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11866_low_27 (Length: 212)
Name: NF11866_low_27
Description: NF11866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11866_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 43383720 - 43383906
Alignment:
| Q |
18 |
agatccatccaaatccttgaccgactaaagttcctgtgaaatcgctgtgacactttgtggcagaatcgctttccttttctctgtgagataaccatgaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43383720 |
agatccatccaaatccttgaccgactaaagttactgtgaaatcgctgtggcactttgcggcagaatcgctttccttttctctgtgagataaccatgaaga |
43383819 |
T |
 |
| Q |
118 |
agagaagatatttagaatc---------ttattgctgctattaaaccgaactgacaccgattcagtttttgatgttttaatcgttct |
195 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43383820 |
agagaagatatttagaatcgaccgtttgatattgctgctattaaaccgaactgacaccgattcagtttttgatgttttaatcgttct |
43383906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University