View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11867_high_15 (Length: 437)
Name: NF11867_high_15
Description: NF11867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11867_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 404; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 404; E-Value: 0
Query Start/End: Original strand, 18 - 429
Target Start/End: Original strand, 55076454 - 55076865
Alignment:
| Q |
18 |
cttctctggttcactagccgtcgccatagctgtcttcttcatcggctacgctgcagatcttggctactccatgggtgatgacctgtcgaagaaaacacgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076454 |
cttctctggttcactagccgtcgccatagctgtcttcttcatcggctacgctgcagatcttggctactccatgggtgatgacctgtcgaagaaaacacgt |
55076553 |
T |
 |
| Q |
118 |
ccccgtgctgttgtcatatttatcttaggtttttgggtactagatgtcgccaacaatatgcttcaaggaccatgtcgtgccttccttggtgaccttgctg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55076554 |
ccccgtgctgttgtcatatttatcttaggtttttgggtactagatgtcgccaacaatatgcttcaaggaccctgtcgtgccttccttggtgaccttgctg |
55076653 |
T |
 |
| Q |
218 |
ccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggttatgccgccggctctttcagcaaact |
317 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076654 |
ccggtgatcaccgtagaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggttatgccgccggctctttcagcaaact |
55076753 |
T |
 |
| Q |
318 |
ctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaacatgtttcttcttatcaatattccttctcgctctcgtt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076754 |
ctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaacatgtttcttcttatcaatattccttctcgctctcgtt |
55076853 |
T |
 |
| Q |
418 |
tcttcctttgct |
429 |
Q |
| |
|
|||||||||||| |
|
|
| T |
55076854 |
tcttcctttgct |
55076865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 118; Significance: 5e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 32 - 305
Target Start/End: Complemental strand, 15125585 - 15125312
Alignment:
| Q |
32 |
tagccgtcgccatagctgtcttcttcatcggctacgctgcagatcttggctactccatgggtgatgacctgtcgaagaaaacacgtccccgtgctgttgt |
131 |
Q |
| |
|
|||| ||||| || || ||||| || || ||||| ||||| ||||||||| ||||||||||||| || ||| ||||||||||||| || ||||| || || |
|
|
| T |
15125585 |
tagcagtcgcgatcgcggtctttttaattggctatgctgctgatcttggccactccatgggtgacgatctgacgaagaaaacacggccacgtgcagtggt |
15125486 |
T |
 |
| Q |
132 |
catatttatcttaggtttttgggtactagatgtcgccaacaatatgcttcaaggaccatgtcgtgccttccttggtgaccttgctgccggtgatcaccgt |
231 |
Q |
| |
|
|| ||| | || || |||||| |||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||| |||| |||||||||||| |
|
|
| T |
15125485 |
gatctttgttttcgggttttggatactagatgtcgccaataatatgcttcaaggaccttgtcgtgccttcattggtgacctcgctggtggtgatcaccgt |
15125386 |
T |
 |
| Q |
232 |
cgaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggttatgccgccggctc |
305 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| ||||||||||| || ||| ||||||||||||| || ||||| |
|
|
| T |
15125385 |
cgaatgagaattggcaatgggatgttctcttttttcatggccgtcggtaatgtccttggttatgctgctggctc |
15125312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 350
Target Start/End: Complemental strand, 43665688 - 43665606
Alignment:
| Q |
268 |
atggccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagc |
350 |
Q |
| |
|
|||||||| || || ||||| ||||| |||||||| ||| ||||||||||| |||| ||||||| |||||| |||| ||||| |
|
|
| T |
43665688 |
atggccgtcggtaacatcctcggttacgccgccggtgcttacagcaaactctttcacgtgtttccgttcaccaaaacaaaagc |
43665606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University