View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11867_high_35 (Length: 247)
Name: NF11867_high_35
Description: NF11867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11867_high_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 104 - 240
Target Start/End: Complemental strand, 6586082 - 6585946
Alignment:
| Q |
104 |
ttttactatgtttttaatgagaaatcatgtagaactataacagcaaatcattagtagtccacttgtctgcttaccatagtgcgaggtatagtgaaaattc |
203 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6586082 |
ttttacaatgtttttaatgagaaatcatgtagaactataacagcaaatcattagtagtccacttgtctgcttaccatagtgcgaggtatagtgaaaattc |
6585983 |
T |
 |
| Q |
204 |
gaactcagaccacttcaattggccagcctctcctatg |
240 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6585982 |
gaaatcagaccacttcaattggccagcctctcctatg |
6585946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University