View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11867_high_37 (Length: 241)
Name: NF11867_high_37
Description: NF11867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11867_high_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 19506555 - 19506778
Alignment:
| Q |
1 |
tcgaaaatgctggaacatcgtatccatcaacttgacaacttcttgtagcttctctagcaaatattggtgttggggggtgcattcttagagtttccttaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506555 |
tcgaaaatgctggaacatcgtatccatcaacttggcaacttcttgtagcttctctagcaaatattggtgttggggggtgcattcttagagtttccttaac |
19506654 |
T |
 |
| Q |
101 |
tactgcttgaagataaggtaagtttggtatatcagattctttgaaaagcctttctttgccaacaattgagtcaatctcttctcttgctttcttgaaaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506655 |
tactgcttgaagataaggtaagtttggtatatcagattctttgaaaagcctttctttgccaacagttgagtcaatctcttctcttgctttcttgaaaaca |
19506754 |
T |
 |
| Q |
201 |
tgtgggtttcttattagttctgct |
224 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
19506755 |
tgtggatttcttattagttctgct |
19506778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University