View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11867_high_42 (Length: 212)
Name: NF11867_high_42
Description: NF11867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11867_high_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 25013967 - 25013791
Alignment:
| Q |
18 |
caaaggtctttatactataagattgagcccatataagaagtgatttttgtattaatgtaactgataacaaaaatttcattcttaacaggatgcatcagat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25013967 |
caaaggtctttatactataagattgagcccatataagaagcgatttttgtattaatgtaactgataaaaaaaatttcattcttaacaggatgcatcagat |
25013868 |
T |
 |
| Q |
118 |
tcatggggtttgtctgtcagtttcctcagcataatcttgttaccaatagttggcaatgcagctgaacatgcaggagc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25013867 |
tcatggggtttgtctgtcagtttcctcagcataatcttgttaccaatagttggcaatgcagctgaacatgcaggagc |
25013791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 101 - 194
Target Start/End: Original strand, 5130720 - 5130813
Alignment:
| Q |
101 |
aacaggatgcatcagattcatggggtttgtctgtcagtttcctcagcataatcttgttaccaatagttggcaatgcagctgaacatgcaggagc |
194 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||||||||| || |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5130720 |
aacaggatgcatcagattcatggggtctatctgtcagcttcctcagcataatcatgctacctatagttggcaatgcagctgaacatgcaggagc |
5130813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University