View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11867_high_43 (Length: 210)
Name: NF11867_high_43
Description: NF11867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11867_high_43 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 4819887 - 4819794
Alignment:
| Q |
1 |
ctctatatgatctttccctttgttacccttctctatgtgtctgcatatcactttggtttttaaacgtaaaggaaatactcatagaatgaagtaa |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4819887 |
ctctatatgatctttccctttgttacccttctctatgtgtctgcatatcactttggtttttaaacgtaaagtaaatactcatagaatgaagtaa |
4819794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 121 - 210
Target Start/End: Complemental strand, 4819721 - 4819628
Alignment:
| Q |
121 |
attggtggtccagcaatggcagtcattgcattaat----ccatccattgaagtagctgtcgttgatatctcgaaatcgcgtattgcagtgtggc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4819721 |
attggtggtccagcaatggcagtcattgcattaatatgtccatccattgaagtagctgtcgttgatatctcgaaatcgcgtattgcagtgtggc |
4819628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 10779477 - 10779423
Alignment:
| Q |
155 |
tccatccattgaagtagctgtcgttgatatctcgaaatcgcgtattgcagtgtgg |
209 |
Q |
| |
|
|||||||||||| ||||| || || ||||||||||||||||| |||||||||||| |
|
|
| T |
10779477 |
tccatccattgacgtagcagtggtcgatatctcgaaatcgcgcattgcagtgtgg |
10779423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University