View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11867_high_7 (Length: 565)
Name: NF11867_high_7
Description: NF11867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11867_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 41 - 278
Target Start/End: Original strand, 35854447 - 35854688
Alignment:
| Q |
41 |
tcgaggaagggtttctcaaaactttaaccttgacaatgacaatgacaaagtgctagatagtgtggttcgtttgagattaatgactctaggcaagt----c |
136 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||| |||||||||||||||||||||||||| | |
|
|
| T |
35854447 |
tcgaggaaaggtttctcaaaactttaaccttgacaatgatgatgtgaaagtgctagataatgtggttcatttgagattaatgactctaggcaagttagac |
35854546 |
T |
|
| Q |
137 |
aacatgaaaaaggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgcta |
236 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35854547 |
aagatgaaaaaggttgcacatgggaggatttggaccggtaaggacgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgcta |
35854646 |
T |
|
| Q |
237 |
tagcaaaattgaaggccaatatacctcaaaacagacaggtta |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35854647 |
tagcaaaattgaaggccaatatacctcaaaacagacaggtta |
35854688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 140 - 327
Target Start/End: Original strand, 10521309 - 10521496
Alignment:
| Q |
140 |
atgaaaaaggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatag |
239 |
Q |
| |
|
|||||| || || ||||| ||||||||| || ||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10521309 |
atgaaagagattccacataggaggatttggatcgggaaggacgcagcatctcaaggtttggttgatgctattggtgggatatcgcgtgctattgctatcg |
10521408 |
T |
|
| Q |
240 |
caaaattgaaggccaatatacctcaaaacagacaggttactcttgtggagctctcaagatatggtcctactctacgcatgctcttaag |
327 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||| |||||| ||||||||||||| |||||| |||||||||| || ||||| |
|
|
| T |
10521409 |
caaaattcaaggccaatatacctcaaaacaaacaggttaatcttgtcgagctctcaagatccggtccttctctacgcatacttttaag |
10521496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 86 - 208
Target Start/End: Complemental strand, 35802630 - 35802504
Alignment:
| Q |
86 |
caaagtgctagatagtgtggttcgtttgagattaatgactctaggcaagt----caacatgaaaaaggttgcacatgggaggatttagaccggtaaggat |
181 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||| ||||||| ||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35802630 |
caaagtgctagataatgtggttcgtttgaggttaatgactctcggcaagttagacaagatgaaaaaggttgcacatgggaggatttggaccggtaaggac |
35802531 |
T |
|
| Q |
182 |
gcagcatctcatggtttggttgatgct |
208 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35802530 |
gcagcatctcatggtttggttgatgct |
35802504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 16 - 79
Target Start/End: Complemental strand, 35802724 - 35802661
Alignment:
| Q |
16 |
aaaatcttactttaaccggttcaattcgaggaagggtttctcaaaactttaaccttgacaatga |
79 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35802724 |
aaaatcttactttaactggttcaattcgaggaacggtttctcaaaactttaaccttgacaatga |
35802661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 106; Significance: 9e-53; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 9e-53
Query Start/End: Original strand, 147 - 296
Target Start/End: Original strand, 47293471 - 47293620
Alignment:
| Q |
147 |
aggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaatt |
246 |
Q |
| |
|
|||||||||| || ||||||| |||| ||||||| |||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
47293471 |
aggttgcacagggaaggatttggaccagtaaggacgcagtatctcatggtttggttgatgctattggtggactatcgcgcgctattgctatagcaaaatt |
47293570 |
T |
|
| Q |
247 |
gaaggccaatatacctcaaaacagacaggttactcttgtggagctctcaa |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
47293571 |
gaaggccaatatacctcaaaacagacaggtcactcttgtggagcgctcaa |
47293620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 4e-52
Query Start/End: Original strand, 147 - 299
Target Start/End: Original strand, 55705896 - 55706048
Alignment:
| Q |
147 |
aggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaatt |
246 |
Q |
| |
|
||||||| ||||||||| ||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
55705896 |
aggttgcgcatgggagggtttggaccggtaaagacgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctattacaaaatt |
55705995 |
T |
|
| Q |
247 |
gaaggccaatatacctcaaaacagacaggttactcttgtggagctctcaagat |
299 |
Q |
| |
|
||| || |||||||||||||||||| |||||| | |||||||||||||||||| |
|
|
| T |
55705996 |
gaaagctaatatacctcaaaacagagaggttattgttgtggagctctcaagat |
55706048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 147 - 277
Target Start/End: Complemental strand, 45876866 - 45876736
Alignment:
| Q |
147 |
aggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaatt |
246 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
45876866 |
aggttgcacaagggagggtttggaccggtaaggatgcagcatcccatggtttggttgatgctattggtgggctatctcgtgctattgctatagcaaaatt |
45876767 |
T |
|
| Q |
247 |
gaaggccaatatacctcaaaacagacaggtt |
277 |
Q |
| |
|
||| || |||||||||||| ||||||||||| |
|
|
| T |
45876766 |
gaaagctaatatacctcaagacagacaggtt |
45876736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 147 - 298
Target Start/End: Complemental strand, 56208661 - 56208510
Alignment:
| Q |
147 |
aggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaatt |
246 |
Q |
| |
|
|||||||||| |||||| ||||||||||||| |||||| ||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
56208661 |
aggttgcacaggggagggtttagaccggtaaagatgcactatctcttggtttggttgatgctattggtgggctatctcgtgctattgctatagcaaaatt |
56208562 |
T |
|
| Q |
247 |
gaaggccaatatacctcaaaacagacaggttactcttgtggagctctcaaga |
298 |
Q |
| |
|
|||||| |||||||||| ||| ||| |||||| ||||||| |||||||| |
|
|
| T |
56208561 |
gaaggctggtatacctcaagacaaacatgttactgttgtggacatctcaaga |
56208510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 151 - 265
Target Start/End: Complemental strand, 45858931 - 45858817
Alignment:
| Q |
151 |
tgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaattgaag |
250 |
Q |
| |
|
|||||| | |||| ||| ||||||||||||||||| |||||||||| |||||||||||||||||||| |||| ||||||||||||||||| ||||||||| |
|
|
| T |
45858931 |
tgcacaggagagggtttggaccggtaaggatgcagtatctcatggtctggttgatgctattggtgggctatcacgtgctattgctatagccaaattgaag |
45858832 |
T |
|
| Q |
251 |
gccaatatacctcaa |
265 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45858831 |
gccaatatacctcaa |
45858817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 173 - 296
Target Start/End: Original strand, 54304265 - 54304388
Alignment:
| Q |
173 |
ggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaattgaaggccaatatacctcaaaacagac |
272 |
Q |
| |
|
|||||||| ||| |||||| |||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54304265 |
ggtaaggacgcaacatctctcggtttggttgatgctattggcgggatgtctcgtgctattgctatagcaaaattgaaggccaatatacctcaaaatagtg |
54304364 |
T |
|
| Q |
273 |
aggttactcttgtggagctctcaa |
296 |
Q |
| |
|
||||||||||||| || ||||||| |
|
|
| T |
54304365 |
aggttactcttgttgaactctcaa |
54304388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 89; Significance: 1e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 147 - 295
Target Start/End: Complemental strand, 7972206 - 7972058
Alignment:
| Q |
147 |
aggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaatt |
246 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| ||||||| |||| |||||||||| |||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
7972206 |
aggttgcacagaggaggatttggaccggtaaagatgcagtatctaatggtttggtcgatgctatcagtggactatcgcgtgctattgctatagcaaaatt |
7972107 |
T |
|
| Q |
247 |
gaaggccaatatacctcaaaacagacaggttactcttgtggagctctca |
295 |
Q |
| |
|
|||||||||| | |||||||||||||| |||||| |||||||||||||| |
|
|
| T |
7972106 |
gaaggccaatcttcctcaaaacagacatgttactattgtggagctctca |
7972058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 147 - 294
Target Start/End: Complemental strand, 7961836 - 7961689
Alignment:
| Q |
147 |
aggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaatt |
246 |
Q |
| |
|
|||||||||| ||||| |||| ||| ||||| |||||| |||| ||| |||||| |||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
7961836 |
aggttgcacaagggagaatttggactggtaaagatgcaatatctaatgatttggtcgatgctattggtggaatatcgcacgctattgctatagcaaaatt |
7961737 |
T |
|
| Q |
247 |
gaaggccaatatacctcaaaacagacaggttactcttgtggagctctc |
294 |
Q |
| |
|
|||||||||||| |||||||||| ||| |||||| |||||||| |||| |
|
|
| T |
7961736 |
gaaggccaatattcctcaaaacaaacatgttactattgtggagttctc |
7961689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 65; Significance: 3e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 146 - 278
Target Start/End: Original strand, 24357469 - 24357601
Alignment:
| Q |
146 |
aaggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaat |
245 |
Q |
| |
|
||||| ||||| ||||| ||| ||| ||||| ||||||||||| |||||||||||||||||||||||||| | || || |||||||| |||||||||| |
|
|
| T |
24357469 |
aaggtagcacaggggagagtttggactggtaaagatgcagcatcacatggtttggttgatgctattggtggcctttcccgagctattgccatagcaaaat |
24357568 |
T |
|
| Q |
246 |
tgaaggccaatatacctcaaaacagacaggtta |
278 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |
|
|
| T |
24357569 |
tgaaggccaatatacctcaagacgaacaggtta |
24357601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University