View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11867_low_26 (Length: 335)
Name: NF11867_low_26
Description: NF11867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11867_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 19506367 - 19506158
Alignment:
| Q |
1 |
tttgcttgttatacaagcaacacttgcaagtttgatacaatgctttgattgggttgttaatgatggtaagagtcatgatattgatatgtctgaagtagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506367 |
tttgcttgttatacaagcaacacttgcaagtttgatacaatgctttgattgggttgttaatgatggtaagagtcatgatattgatatgtctgaagtagga |
19506268 |
T |
 |
| Q |
101 |
agggttactgtgtttttggctaaaccattgaagtgcaagcctgttccacattttgttccattctcttctgcctaaggaatttggatcaagaatcaaattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506267 |
agggttactgtgtttttggctaaaccattgaagtgcaagcctgttccacattttgttccattctcttctgcctaaggaatttggatcaagaatcaaattc |
19506168 |
T |
 |
| Q |
201 |
atttctcaag |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
19506167 |
atttctcaag |
19506158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 265 - 329
Target Start/End: Complemental strand, 19506103 - 19506039
Alignment:
| Q |
265 |
ggaagtgtatgtgaaaacttcttggcaggataaaaataagtgattaggtaatccaattcttctct |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506103 |
ggaagtgtatgtgaaaacttcttggcaggataaaaataagtgattaggtaatccaattcttctct |
19506039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University