View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11867_low_41 (Length: 239)
Name: NF11867_low_41
Description: NF11867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11867_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 7242476 - 7242698
Alignment:
| Q |
1 |
caagagtatgattgtgatgaaccaaaagtctgttttgtctaaggtaatggcgaaaccaccgagaaggacaacagtcgcccatataaaaccaagagttccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7242476 |
caagagtatgattgtgatgaaccaaaagtctgttttgtctaaggtaatggcgaaaccaccgagaaggacaacagtcgcccatataaaaccaagagttccc |
7242575 |
T |
 |
| Q |
101 |
aaaccagttgctgctttttcaagcacggcaaggcgcagagcaaagagagtaagtttcttttccggtgctctaactgttgttgaagactcattagaatctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7242576 |
aaaccagttgctgctttttcaagcacggcaaggcgcagagcaaagagagtaagtttcttttccggtgctctaactgttgttgaagactcattagaatctt |
7242675 |
T |
 |
| Q |
201 |
ctttatcaccttcaccactatct |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7242676 |
ctttatcaccttcaccactatct |
7242698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 5 - 182
Target Start/End: Complemental strand, 48730675 - 48730497
Alignment:
| Q |
5 |
agtatgattgtgatgaaccaaaagtctgttttgtc-taaggtaatggcgaaaccaccgagaaggacaacagtcgcccatataaaaccaagagttcccaaa |
103 |
Q |
| |
|
|||||||| |||| ||||||||| || ||||| || |||||| | ||||||||||| |||||||||||||| ||||| || |||| ||||||||| || |
|
|
| T |
48730675 |
agtatgatggtgacgaaccaaaaatcagttttttcctaaggtgacagcgaaaccaccaagaaggacaacagtggcccagatgaaactaagagttcctaac |
48730576 |
T |
 |
| Q |
104 |
ccagttgctgctttttcaagcacggcaaggcgcagagcaaagagagtaagtttcttttccggtgctctaactgttgttg |
182 |
Q |
| |
|
|| |||| ||||||||||||||| ||||| | |||||||| || || ||||||||||| |||||| || |||||||| |
|
|
| T |
48730575 |
cctgttgatgctttttcaagcactgcaagctgaagagcaaaaagggtcagtttcttttctggtgctatatttgttgttg |
48730497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University