View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11867_low_42 (Length: 224)
Name: NF11867_low_42
Description: NF11867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11867_low_42 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 224
Target Start/End: Complemental strand, 46786693 - 46786488
Alignment:
| Q |
19 |
cttacgccgtcctcggagtccaacctgattgctcagccgcggaaattaaagccgcttttcgatccaaagtatcaacatcaatcattaaatatttatcacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46786693 |
cttacgccgtcctcggagtccaacctgattgctcagccgcggaaattaaagccgcttttcgatccaaagtatcaacatcaatcattaaatatttatcacc |
46786594 |
T |
|
| Q |
119 |
attttcattctcttcaattaaattcaagtttctttctctttaatttattacataggtaaaacagttccaccctgacctcaacagagatgaaaatgaaaca |
218 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46786593 |
attttcattctcttcgattcaattcaagtttctttctctttaatttattacataggtaaaacagttccaccctgacctcaacagagatgaaaatgaaaca |
46786494 |
T |
|
| Q |
219 |
tattct |
224 |
Q |
| |
|
|||||| |
|
|
| T |
46786493 |
tattct |
46786488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University