View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11868_high_4 (Length: 229)

Name: NF11868_high_4
Description: NF11868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11868_high_4
NF11868_high_4
[»] chr3 (2 HSPs)
chr3 (7-108)||(35449075-35449176)
chr3 (174-220)||(35449246-35449292)


Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 7 - 108
Target Start/End: Original strand, 35449075 - 35449176
Alignment:
7 ctgccatacgctgctatagttacagtgtgtaatatccattcattcacttttgattggcttggacataagcttgtaggttgtgtattctttagagctattg 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
35449075 ctgccatacgctgctatagttacagtgtgtaatatccattcattcacttttgattggcatggacataagcttgtaggttgtgtattctttagagctattg 35449174  T
107 tg 108  Q
    ||    
35449175 tg 35449176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 174 - 220
Target Start/End: Original strand, 35449246 - 35449292
Alignment:
174 aaaaaggaaaatgataactagtgtctagtacattagttaaggaagta 220  Q
    ||||||||||||||||||||||||  |||||||||||||||||||||    
35449246 aaaaaggaaaatgataactagtgttaagtacattagttaaggaagta 35449292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University