View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11868_high_4 (Length: 229)
Name: NF11868_high_4
Description: NF11868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11868_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 7 - 108
Target Start/End: Original strand, 35449075 - 35449176
Alignment:
| Q |
7 |
ctgccatacgctgctatagttacagtgtgtaatatccattcattcacttttgattggcttggacataagcttgtaggttgtgtattctttagagctattg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35449075 |
ctgccatacgctgctatagttacagtgtgtaatatccattcattcacttttgattggcatggacataagcttgtaggttgtgtattctttagagctattg |
35449174 |
T |
 |
| Q |
107 |
tg |
108 |
Q |
| |
|
|| |
|
|
| T |
35449175 |
tg |
35449176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 174 - 220
Target Start/End: Original strand, 35449246 - 35449292
Alignment:
| Q |
174 |
aaaaaggaaaatgataactagtgtctagtacattagttaaggaagta |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35449246 |
aaaaaggaaaatgataactagtgttaagtacattagttaaggaagta |
35449292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University