View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11869_low_11 (Length: 242)

Name: NF11869_low_11
Description: NF11869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11869_low_11
NF11869_low_11
[»] chr1 (1 HSPs)
chr1 (17-224)||(31808856-31809063)


Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 224
Target Start/End: Complemental strand, 31809063 - 31808856
Alignment:
17 gaaatcaatgtagtataattcagttgactatactttcttatttattggtgccacaactaaagcatataagactgatattgatgtgaaacttttcacttca 116  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31809063 gaaatcaatgtagtataattcagttgactatactctcttatttattggtgccacaactaaagcatataagactgatattgatgtgaaacttttcacttca 31808964  T
117 ttgtggggggtagaaaaatgaggttgtttttcactcaaattttgtccttgatcatttcattcaactagctagcaaccaggcaaaagatcttgtcaatgtc 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31808963 ttgtggggggtagaaaaatgaggttgtttttcactcaaattttgtccttgatcatttcattcaactagctagcaaccaggcaaaagatcttgtcaatgtc 31808864  T
217 tttcatat 224  Q
    ||||||||    
31808863 tttcatat 31808856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University