View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11869_low_11 (Length: 242)
Name: NF11869_low_11
Description: NF11869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11869_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 224
Target Start/End: Complemental strand, 31809063 - 31808856
Alignment:
| Q |
17 |
gaaatcaatgtagtataattcagttgactatactttcttatttattggtgccacaactaaagcatataagactgatattgatgtgaaacttttcacttca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31809063 |
gaaatcaatgtagtataattcagttgactatactctcttatttattggtgccacaactaaagcatataagactgatattgatgtgaaacttttcacttca |
31808964 |
T |
 |
| Q |
117 |
ttgtggggggtagaaaaatgaggttgtttttcactcaaattttgtccttgatcatttcattcaactagctagcaaccaggcaaaagatcttgtcaatgtc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31808963 |
ttgtggggggtagaaaaatgaggttgtttttcactcaaattttgtccttgatcatttcattcaactagctagcaaccaggcaaaagatcttgtcaatgtc |
31808864 |
T |
 |
| Q |
217 |
tttcatat |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
31808863 |
tttcatat |
31808856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University